Disclaimer: Early release articles are not considered as final versions. Any changes will be reflected in the online version in the month the article is officially released.

To the Editor: We read with interest but also concern the article by Long et al. (1) describing putative doxycycline resistance–associated variants of the Treponema pallidum ribosomal RNA 16S gene. Determining if T. pallidum can become resistant to doxycycline is urgent, given its use for both prevention (i.e., doxy-PEP) and treatment of syphilis, especially amid ongoing shortages of benzathine penicillin G.

Figure

Ratio of G966T to wild-type G alleles among R1 reads of Treponema pallidum. We downloaded raw reads from the European Nucleotide Archive (BioProjects PRJEB28546 and PRJEB33181), which were re-assembled in Long et al. (1) and generated synthetic reads with the error profile of the Illumina HiSeq 2500 (Illumina ART; https://www.niehs.nih.gov/research/resources/software/biostatistics/art) from 29 high-quality T. pallidum assemblies from GenBank using Illumina ART. We removed reads containing host sequences by using kraken 2 (https://github.com/DerrickWood/kraken2), performed quality and adaptor trimming with Trimmomatic version 0.39 (https://github.com/usadellab/trimmomatic), and filtered remaining read pairs to include only reads unambiguously arising from T. pallidum (taxid 160) using the standard kraken 2 16GB database with the default kmer length of 35. We isolated reads containing sequences from either of the rRNA loci by using bbduk (https://sourceforge.net/projects/bbmap) requiring a 21-mer match to the T. pallidum 16S locus sequence with 1 or 0 mismatches. For unambiguous identification and enumeration of the wild-type or G966T variant, R1 reads were grepped for perfect matches to the 51-base sequence centered on nt 966 (bold), equivalent to positions 232265 and 280700 in the SS14 reference sequence chromosome (CP004011): GGTGGAGCATGTGGTTTAATTCGATGATACGCGAGGAACCTTACCCGGGTT (wild-type) and GGTGGAGCATGTGGTTTAATTCGATTATACGCGAGGAACCTTACCCGGGTT (G966T), and the reverse complement of each. A) G:T ratio at rRNA position 966 in samples with >100 R1 reads (n = 622). Each point represents a sample; points below the dotted line contain 0 G966T reads. Boxplots represent medians and interquartile ranges. Samples identified in Long et al. do not have a G966T allele frequency exceeding the technical noise from PCR and sequencing. B) Total R1 reads containing wild-type and mutant sequence in 9 samples identified by Long et al. The total reads are shown for each sample and the number of reads supporting the G966T mutation is shown in parentheses.

Figure. Ratio of G966T to wild-type G alleles among R1 reads of Treponema pallidum. We downloaded raw reads from the European Nucleotide Archive (BioProjects PRJEB28546 and PRJEB33181), which were…

As the groups that generated most of the sequencing data reanalyzed in Long et al. (1), our analyses were unable to replicate the primary finding of a heterozygous G966T 16S mutation (Escherichia coli numbering) in 9 samples. Using standard pathogen genomics methods (Figure), we did not find the variant in any reanalyzed sample at an allele frequency exceeding background technical noise.

Of note, >98% of publicly available T. pallidum genomes were generated from clinical specimens by metagenomic sequencing using hybrid capture probes. That method retains conserved non–T. pallidum DNA, such as ribosomal operons from other bacteria, in the sample (2,3), and can introduce errors when merging fragmented DNA reads into consensus sequences. Such artifacts may be incorporated into consensus T. pallidum genomes available from public resources such as pubMLST (https://pubmlst.org) or GenBank and misinterpreted as real mutations. Although Long et al. (1) reported filtering for reads arising from Treponema, we and others have shown the necessity of more stringent methods, such as competitive mapping versus related ribosomal sequences (2) or requiring near-identity to known T. pallidum rRNA sequences (4), to avoid inadvertent reporting errors.

The development of doxycycline resistance by T. pallidum could have devastating consequences for the control of syphilis and is being closely monitored by clinicians and scientists. We are encouraged by increasing genomic surveillance of T. pallidum, providing a mechanism for early detection of the emergence of resistance-associated variants.


Top

Mathew A. Beale, Michael Marks, Annie Luetkemeyer, Connie Celum, Matthew R. Golden, Lorenzo Giacani, and Nicole A.P. LiebermanComments to Author 

Author affiliation: Wellcome Sanger Institute, Hinxton, UK (M.A. Beale); London School of Hygiene and Tropical Medicine, London, UK (M. Marks); University of California San Francisco, San Francisco, California, USA (A. Luetkemeyer); University of Washington, Seattle, Washington, USA (C. Celum, M.R. Golden, L. Giacani, N.A.P. Lieberman)



Source link

Leave a Reply

Your email address will not be published. Required fields are marked *